View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2286_low_14 (Length: 275)
Name: NF2286_low_14
Description: NF2286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2286_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 18 - 273
Target Start/End: Original strand, 32138897 - 32139152
Alignment:
| Q |
18 |
gataaaacatcttcagcaagttcaccgctggtggcggtgtgggtaatgctattgtccggggtgacaccacaggtgttgttgttgcagccaggttttggtg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32138897 |
gataaaacatcttcagcaagttcaccgctggtggcggtgtgggtaatgctattgtccggggtgacaccacaagtgttgttgttgcagccaggttttggtg |
32138996 |
T |
 |
| Q |
118 |
atgagaaacaatcaccacagccgtcggattttgcgagggagcattgggctgaacggcagcgtgcagggcggtatgtggaagaaatgtatttgttttcgca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32138997 |
atgagaaacaatcaccacagccgtcggaatttgcaagggagcattgggctgaacggcagcgtgcagggcggtatgtggaagaaatgtatttgttttcgca |
32139096 |
T |
 |
| Q |
218 |
gtcaacccaaagaaactggccaccgagatcgacgatgacgttcagtgggactaatg |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32139097 |
gtcaacccaaagaaactggccaccgagatcgacgatgacgttcagtgggactaatg |
32139152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 18 - 270
Target Start/End: Original strand, 32148287 - 32148539
Alignment:
| Q |
18 |
gataaaacatcttcagcaagttcaccgctggtggcggtgtgggtaatgctattgtccggggtgacaccacaggtgttgttgttgcagccaggttttggtg |
117 |
Q |
| |
|
||||||| ||||||||| ||||||||||| ||||| | ||||||| |||||| | |||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32148287 |
gataaaatatcttcagccagttcaccgctcatggcgctctgggtaacgctattccctggggcaacactgcaggtgttgttgttgcagccaggttttggtg |
32148386 |
T |
 |
| Q |
118 |
atgagaaacaatcaccacagccgtcggattttgcgagggagcattgggctgaacggcagcgtgcagggcggtatgtggaagaaatgtatttgttttcgca |
217 |
Q |
| |
|
||||||||||| |||||||| ||||| |||| || |||||||||||||| || || || |||||||| ||||||||||| |||||||| | ||||||||| |
|
|
| T |
32148387 |
atgagaaacaaacaccacagtcgtcgaatttggcaagggagcattgggcagagcgacaccgtgcaggacggtatgtggaggaaatgtactggttttcgca |
32148486 |
T |
 |
| Q |
218 |
gtcaacccaaagaaactggccaccgagatcgacgatgacgttcagtgggacta |
270 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32148487 |
atcaacccagagaaacaggccaccgagatcgacgatgatgttcagtgggacta |
32148539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 94 - 270
Target Start/End: Original strand, 32127187 - 32127363
Alignment:
| Q |
94 |
tgttgttgcagccaggttttggtgatgagaaacaatcaccacagccgtcggattttgcgagggagcattgggctgaacggcagcgtgcagggcggtatgt |
193 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| || ||||| ||||||||||||||||| || |||| ||| ||||||||||||| |
|
|
| T |
32127187 |
tgttgttgcagccgggttttggtgatgagaaacaatcaccacagctatcagatttggcgagggagcattgggcggaggggcaccgtacagggcggtatgt |
32127286 |
T |
 |
| Q |
194 |
ggaagaaatgtatttgttttcgcagtcaacccaaagaaactggccaccgagatcgacgatgacgttcagtgggacta |
270 |
Q |
| |
|
||| ||| |||| | |||||| ||||| ||||| ||||| | ||| || ||||| |||| | ||| |||||||||| |
|
|
| T |
32127287 |
ggaggaagtgtagtggttttcacagtcgacccagagaaatttgccgccaagatcaacgacaaggtttagtgggacta |
32127363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University