View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2286_low_16 (Length: 252)
Name: NF2286_low_16
Description: NF2286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2286_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 52576591 - 52576373
Alignment:
| Q |
1 |
tttgcagattcaatgatggtaaggtcagaattagccgaggagacaatgaaattattttcgtacatactcgcacaaatgcacagtagttgtattgtattat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || |
|
|
| T |
52576591 |
tttgcagattcaatgatggtaaggtcagaattagccgaggagacaatgaaattattttcgtacatgctcgcacaaatgcacagtagttgtatt-----at |
52576497 |
T |
|
| Q |
101 |
tgctagctaaatcagtattctaaatacaacatggaaggtctattactctatttatttactttcatttttagctgcgttataaaaaatcactatgttatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52576496 |
tgctagctaaatcagtattctaaatacaacatggaaggtctattactctatttattaactttcatttttagctgcgttataagaaatcactatgttatta |
52576397 |
T |
|
| Q |
201 |
cttttattttaactttaatataaa |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
52576396 |
cttttattttaactttaatataaa |
52576373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University