View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2286_low_20 (Length: 241)
Name: NF2286_low_20
Description: NF2286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2286_low_20 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 241
Target Start/End: Original strand, 5013517 - 5013740
Alignment:
| Q |
18 |
tcttcatttttagagtattgaggcttgacatagtaccatacattaagctaaggagtactgcacagaattagaggttatactttttagggaagaatatatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5013517 |
tcttcatttttagagtattgaggcttcacatggtaccatacgttaagctaaggagtactgcacagaattagaggttatactttttagggaagaatatatt |
5013616 |
T |
|
| Q |
118 |
ggcatttaaagtgtaatatcgattacatcaagccatgatcattgccaaggacgaattgatgagagcctactcattgccaataacctttgtgatgtgaaga |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5013617 |
ggcatttaaagtgtaatatcgattacatcaagccatgatcattgccaaggacgaattgatgagagcctactcattgccaataaccttggtgatgtgaaga |
5013716 |
T |
|
| Q |
218 |
tagttggcaatcagggacggatct |
241 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
5013717 |
tagttggcaatcagggacggatct |
5013740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University