View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2286_low_21 (Length: 240)
Name: NF2286_low_21
Description: NF2286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2286_low_21 |
 | |
|
| [»] scaffold0197 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0197 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: scaffold0197
Description:
Target: scaffold0197; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 7116 - 6897
Alignment:
| Q |
1 |
attgaacctaatccaatcttagaaaaccgatttgtgagacgatgaggacccaccgattatagctaatacttttaaattactccctaaatttaagatagaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7116 |
attgaacctaatccaatcttagaaaaccgatttttgagacgatgaggacccaccgattatagctaatacttttaaattact-cctaaatttaagatagaa |
7018 |
T |
|
| Q |
101 |
agaagaaagctaannnnnnnnnaggactacgtaatttgttgctgcgcgatgcaatgcattagttgcgcctactatgtcctgacattacaaagcggtttta |
200 |
Q |
| |
|
||||||||||||| || |||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7017 |
agaagaaagctaa-ttttttttagcactacgtaatttgttgatgcgcgatgcaatgcagtagttgcgcctactatgtcctgacattacaaagcggtttta |
6919 |
T |
|
| Q |
201 |
atagtgatttacaatcacactg |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
6918 |
atagtgatttacaatcacactg |
6897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University