View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2286_low_7 (Length: 323)
Name: NF2286_low_7
Description: NF2286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2286_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 18 - 309
Target Start/End: Complemental strand, 35257618 - 35257319
Alignment:
| Q |
18 |
attacaaacattaaaaccaaagatatcaaggtttatgaaaatccaaaa--------tnnnnnnncattacctaattcccagctgcaaattaagcatgagc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35257618 |
attacaaacattaaaaccaaagatatcaaggtttatgaaaatccaaaaatccaaaataaaaaaacattacctaattcccagctgcaaattaagcatgagc |
35257519 |
T |
 |
| Q |
110 |
tcaaaatttttgtgccctttgcatatagtctcaccctgcctctttgatttctttggtgctttcaaaggctgcagttgattcaaagcatcatcatcagcat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35257518 |
tcaaaatttttgtgccctttgcatatagtctcaccctgcctctttgatttctttggtgctttcaaaggctgcagttgattcaaagcatcatcatcagcat |
35257419 |
T |
 |
| Q |
210 |
catcgatacgtgaactaattgaatcatcatcataatcactccctaaagtaggaggagttctattaccaccactactagcatcaccctctcctcgtcctcc |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35257418 |
catcgatacgtgaactaattgaatcatcatcataatcactccctaaagtaggaggagttctattaccaccactactagcatcaccctctcctcgtcctcc |
35257319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 61; Significance: 4e-26; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 76 - 176
Target Start/End: Original strand, 19642208 - 19642308
Alignment:
| Q |
76 |
ttacctaattcccagctgcaaattaagcatgagctcaaaatttttgtgccctttgcatatagtctcaccctgcctctttgatttctttggtgctttcaaa |
175 |
Q |
| |
|
|||||| ||||||| || ||||| |||||||||||| |||||||||| ||||||||||| || || ||||||||||||||||||||||||||||||||| |
|
|
| T |
19642208 |
ttacctgattcccaattgtaaattgagcatgagctcataatttttgtgtcctttgcatatggtttctccctgcctctttgatttctttggtgctttcaaa |
19642307 |
T |
 |
| Q |
176 |
g |
176 |
Q |
| |
|
| |
|
|
| T |
19642308 |
g |
19642308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 89 - 141
Target Start/End: Original strand, 14520384 - 14520436
Alignment:
| Q |
89 |
agctgcaaattaagcatgagctcaaaatttttgtgccctttgcatatagtctc |
141 |
Q |
| |
|
|||||||||||||||||||| ||| |||| || ||||||||| | |||||||| |
|
|
| T |
14520384 |
agctgcaaattaagcatgaggtcataattcttatgccctttggaaatagtctc |
14520436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University