View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2287_low_8 (Length: 235)
Name: NF2287_low_8
Description: NF2287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2287_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 2131630 - 2131837
Alignment:
| Q |
1 |
aattcgacccataaggaagaattgtttgtgtgggatggctagagtgaggagaacttccaaaaacttaagagacgattaacttctgcaccgatcatagtta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2131630 |
aattcgacccataaggaagaattgtttgtgtgggatggctagagtgaggagaacttccaaaaacttaagagacgattaacttctgcaccga--------- |
2131720 |
T |
|
| Q |
101 |
cccgatccgagtaagccttttgtggttaatatcttgatttgttatggtggaggagaaataacactattttcttgtggtatactcttagttttaaaagaaa |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2131721 |
-----tccgagtaagccttttgtggtttatatcttgatttgttatggtggaggagaaataacactattttcttgttgtatactcttagttttaaaagaaa |
2131815 |
T |
|
| Q |
201 |
agttataaaacagaaaaaattg |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2131816 |
agttataaaacagaaaaaattg |
2131837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University