View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2288_high_6 (Length: 359)
Name: NF2288_high_6
Description: NF2288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2288_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 119 - 354
Target Start/End: Complemental strand, 55321409 - 55321177
Alignment:
| Q |
119 |
gttaaacatgcaatcagggtaggaattagtgaatgatctcaagtcagttatccttgcacaataaggtaaattaattttgaatgtctaatctttcttagat |
218 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55321409 |
gttaaacatgcaatcagggcaggaattagtgaatgatctcaagtcagttatccttgcacaataaggtaaattaattttgaatgtctaatctttcttagat |
55321310 |
T |
 |
| Q |
219 |
gtatagtgcagtggaaatttggagtctttagaatgaacgaaaagtagcttgcttttctcttggttagcaccatttttatttcgattgtcatgatagcccc |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
55321309 |
gtatagtgcagtggaaatttggagtctttagaatgaatgaaaagtagcttgcttttctcttggttagcaccatttttatttcgattgtc---atagcccc |
55321213 |
T |
 |
| Q |
319 |
agtattattacttgattagtattatttgtttaatgt |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
55321212 |
agtattattacttgattagtattatttgtttgatgt |
55321177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 11 - 45
Target Start/End: Complemental strand, 55321791 - 55321757
Alignment:
| Q |
11 |
gagaagaagataaatgaaatatctatcttgaattg |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
55321791 |
gagaagaagataaatgaaatatctatcttgaattg |
55321757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University