View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2288_low_16 (Length: 234)

Name: NF2288_low_16
Description: NF2288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2288_low_16
NF2288_low_16
[»] chr4 (3 HSPs)
chr4 (131-222)||(4795823-4795913)
chr4 (55-131)||(4795959-4796035)
chr4 (1-63)||(4796353-4796416)


Alignment Details
Target: chr4 (Bit Score: 84; Significance: 5e-40; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 131 - 222
Target Start/End: Complemental strand, 4795913 - 4795823
Alignment:
Q  131 cattatttaatcaaagtggagacttttctgatggcatggatattgagcctttgaaaccaaacttctgatacatggttttctgagatgtaact 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  4795913 cattatttaatcaaagtggagacttttctgatggcatggatattgagcc-ttgaaaccaaacttctgatacatggttttctgagatgtaact 4795823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 55 - 131
Target Start/End: Complemental strand, 4796035 - 4795959
Alignment:
Q  55 tagattttaatatatttcaaagtacaaaggatggataagtgtttcacatgatttcaatatactctttctttttgcac 131  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4796035 tagattttaatatatttcaaagtacaaaggatggataagtgtttcacatgatttcaatatactctttctttttgcac 4795959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 4796416 - 4796353
Alignment:
Q  1 taattaattattgaagatcaaaatcaaaa-cttgatagagttatacaattcaatttagatttta 63  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  4796416 taattaattattgaagatcaaaatcaaaaacttgatagagttatacaattcaatttagatttta 4796353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University