View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2289_high_3 (Length: 298)
Name: NF2289_high_3
Description: NF2289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2289_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 7e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 30 - 239
Target Start/End: Original strand, 42153611 - 42153812
Alignment:
| Q |
30 |
tataggaagcttgaagcttcgtcctgctcaaacgatttgtccacttctcattaaggtatgagacgtatccaaaatttatttatcatttagtgtaaatttt |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |||||||||||||| ||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42153611 |
tataggaagcttgaagcttcgtcctgctcgaacgacttgtccacttctcagtaaagtatgagacgtatccaaaatttacttatcatttagtgtaaatttt |
42153710 |
T |
 |
| Q |
130 |
tatttttgttgggcatgatataaatagactcctataaaatactaatcactttaagtcttatccacttgaattcaaagagagatcaactttactttatttt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42153711 |
tatttttgttgggcatgatataaatagactcctataaaatacta--------aagtcttatccacttgaattcaaagagagatcaactttactttatttt |
42153802 |
T |
 |
| Q |
230 |
catatcaccc |
239 |
Q |
| |
|
|||||||||| |
|
|
| T |
42153803 |
catatcaccc |
42153812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University