View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2290_low_2 (Length: 297)
Name: NF2290_low_2
Description: NF2290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2290_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 19 - 289
Target Start/End: Original strand, 13451717 - 13451999
Alignment:
| Q |
19 |
aattcaatggagcctcaagtatattgtagatgtagaaataaaaatatcaatcattcattaaattataaagtaccagcagtattttattctctaaaaatta |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13451717 |
aattcaatggagcctcaagtatattgtagatgtagaaataaaaatatcaatcattgattaaattataaagtaccagcagtattttattctctaaaaatta |
13451816 |
T |
|
| Q |
119 |
ataatggatcactgattcttgtgactgtgaggtgcttttcattcactgaaaaagaaacaaatacggtaaaataaaatctatatctatctatatatatcac |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
13451817 |
ataatggatcactgattcttgtgactgtgaggtgcttttcattcactgaaaaagaaacaaatatggtaaaataaaatctatatctatctatatatatcac |
13451916 |
T |
|
| Q |
219 |
atgcaaactcatcctcattg------------cacaaacacaaacacatggcttcctcactttcattactcactcttcatctc |
289 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13451917 |
atgcaaactcatcctcattgcacttcactcaacacaaacacaaacacatggcttcctcactttcattactcactcttcttctc |
13451999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University