View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2291_low_4 (Length: 334)
Name: NF2291_low_4
Description: NF2291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2291_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 83; Significance: 3e-39; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 23 - 141
Target Start/End: Complemental strand, 8005422 - 8005304
Alignment:
| Q |
23 |
aacatgttagattgaactaattagataaagtttattgtaattgaatatcttttacttaagannnnnnnnacacaaaaagagatttagaggggtcgatgct |
122 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
8005422 |
aacatgttagatcgaactaattagataaagtttattgtaattgaatgtcttttacttaagattttttttacacaaaaagaggtttagaggggtcgatgct |
8005323 |
T |
|
| Q |
123 |
gcaaaatcctgatcatcat |
141 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
8005322 |
gcaaaatcctgatcatcat |
8005304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 258 - 326
Target Start/End: Complemental strand, 8005191 - 8005121
Alignment:
| Q |
258 |
catgagaggcaactcccatcaaagagctagcgaggcgaacggcc--agacacccaccttaaaccctttgct |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
8005191 |
catgagaggcaactcccatcaaagagctagcgaggcgaacggccaaagacacccaccttgaaccctttgct |
8005121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University