View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2291_low_4 (Length: 334)

Name: NF2291_low_4
Description: NF2291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2291_low_4
NF2291_low_4
[»] chr6 (2 HSPs)
chr6 (23-141)||(8005304-8005422)
chr6 (258-326)||(8005121-8005191)


Alignment Details
Target: chr6 (Bit Score: 83; Significance: 3e-39; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 23 - 141
Target Start/End: Complemental strand, 8005422 - 8005304
Alignment:
23 aacatgttagattgaactaattagataaagtttattgtaattgaatatcttttacttaagannnnnnnnacacaaaaagagatttagaggggtcgatgct 122  Q
    |||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||        |||||||||||| ||||||||||||||||||    
8005422 aacatgttagatcgaactaattagataaagtttattgtaattgaatgtcttttacttaagattttttttacacaaaaagaggtttagaggggtcgatgct 8005323  T
123 gcaaaatcctgatcatcat 141  Q
    |||||||||||||||||||    
8005322 gcaaaatcctgatcatcat 8005304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 258 - 326
Target Start/End: Complemental strand, 8005191 - 8005121
Alignment:
258 catgagaggcaactcccatcaaagagctagcgaggcgaacggcc--agacacccaccttaaaccctttgct 326  Q
    ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||| |||||||||||    
8005191 catgagaggcaactcccatcaaagagctagcgaggcgaacggccaaagacacccaccttgaaccctttgct 8005121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University