View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2291_low_9 (Length: 231)
Name: NF2291_low_9
Description: NF2291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2291_low_9 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 20 - 231
Target Start/End: Complemental strand, 21876808 - 21876600
Alignment:
| Q |
20 |
agtttactagcagcttgatcatcaacattgagaaattcagtaaaccattcttgatcagtccattctccaggttcaccaagttggttagcagacaaaacag |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21876808 |
agtttactagcagcttgatcatcaacattgagaaattcagtaaaccattcttgatcagtccattctccaggttcatcaagttggttagcagacaaaacag |
21876709 |
T |
|
| Q |
120 |
aaggcaacctaacaacagtagacttcaaaggatcatatataggttgccattgagaaaagccatcatgcataccctcaaattggtttgaatttgaagggta |
219 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
21876708 |
aaggcaacct---aacagtagacttcaaaggatcgtatataggttgccattgagaaaagccatcattcatgccctcaaattggtttgaatttgaagggta |
21876612 |
T |
|
| Q |
220 |
aaatatctcctt |
231 |
Q |
| |
|
|||||||||||| |
|
|
| T |
21876611 |
aaatatctcctt |
21876600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University