View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2292_high_10 (Length: 286)
Name: NF2292_high_10
Description: NF2292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2292_high_10 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 52 - 286
Target Start/End: Original strand, 3603487 - 3603721
Alignment:
| Q |
52 |
tgttttgctggtaaaatggacaatagtcaatagtatagatcatgtcataggttatattcattgctcacttcaatcggacatcgcaagcaatttgatattt |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3603487 |
tgttttgctggtaaaatggacaatagtcaatagtatagatcatgtcataggttatattcattgctcacttcactcggacatcgcaagcaatttgatattt |
3603586 |
T |
|
| Q |
152 |
tatgtacgcttaatagagtcattcataaatctnnnnnnntatttgagaccctaatatttttagaagcccaatcatcaaggatgcctctgagatctgtccc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3603587 |
tatgtacgcttaatagagtcattcataaatctaaaaaaatatttgagaccctaatatttttagaagcccaatcatcaaggatgcctctgagatctgtccc |
3603686 |
T |
|
| Q |
252 |
aagaaattacactaattgttcaacagtagaatttt |
286 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3603687 |
aagaaattacactaattgttcaacagtagcatttt |
3603721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University