View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2292_low_29 (Length: 232)
Name: NF2292_low_29
Description: NF2292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2292_low_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 1e-58; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 11104508 - 11104386
Alignment:
| Q |
1 |
ctttaagttgatccaatgtggagaagggtccaggaaggttttgatttgcaagagttatgttggcagttaagctatcccttcttcccaatggaattggcca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
11104508 |
ctttaagttgatccaatgtggagaagggtccgggaaggttttgatttgcaagagttatgttggcggttaagctatcccttcttcccaatggaattggcca |
11104409 |
T |
 |
| Q |
101 |
tgagggacctcctccctgttcat |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
11104408 |
tgagggacctcctccctgttcat |
11104386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 11097485 - 11097363
Alignment:
| Q |
1 |
ctttaagttgatccaatgtggagaagggtccaggaaggttttgatttgcaagagttatgttggcagttaagctatcccttcttcccaatggaattggcca |
100 |
Q |
| |
|
|||||||||||||||||||| | |||||| | |||||||||||||||||||| | | ||| || ||||| |||||||||||||||||||||||| |||| |
|
|
| T |
11097485 |
ctttaagttgatccaatgtgaaaaagggtgctggaaggttttgatttgcaagggcttggtttgctgttaaactatcccttcttcccaatggaatttgcca |
11097386 |
T |
 |
| Q |
101 |
tgagggacctcctccctgttcat |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
11097385 |
tgagggacctcctccctgttcat |
11097363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University