View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2292_low_4 (Length: 481)
Name: NF2292_low_4
Description: NF2292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2292_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 178 - 439
Target Start/End: Complemental strand, 965720 - 965462
Alignment:
| Q |
178 |
tatatatttcaagaccaactaagaatgttagaaatgatcctcgtcgatctgcatgttcttggaatgt-----caatatataaacaatcaagatgcttctt |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
965720 |
tatatatttcaagaccaactaagaatgttagaaatgatcctcgtcgatctgcatgttcttggaatgttatgtcaatatataaacaatcaagatgcttctt |
965621 |
T |
|
| Q |
273 |
gtttaatgcacacacttgattcttatgtatatataggtgtctaatgcgagaaacaatgtcaccaacccatacatcagggaattatttagggttcctgcat |
372 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
965620 |
gtttaatgcacacacttgattcttatgtatatataggtgtctaatgcgagaaacaatgtcaccaacccatacatcagggaattatttaggggtc------ |
965527 |
T |
|
| Q |
373 |
ggctgcatcaaaggcaatatcacgaaacatgtcgtttgttacatggatgcaagttgtggcaaaaatt |
439 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
965526 |
--ctgcatcaaaggcaatatcacgaaacatgtcgtctgttacatggatacaagttgtggcaaaaatt |
965462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University