View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2293_low_16 (Length: 238)

Name: NF2293_low_16
Description: NF2293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2293_low_16
NF2293_low_16
[»] chr1 (1 HSPs)
chr1 (43-167)||(36254410-36254534)


Alignment Details
Target: chr1 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 43 - 167
Target Start/End: Original strand, 36254410 - 36254534
Alignment:
43 tctttctttcatatagaaatttaaatgcgatagaaaaagagtgnnnnnnnnttggatgtatattttaaaactaattatcaaactttataatctataccaa 142  Q
    |||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||    
36254410 tctttctttcatatagaaatttaaatgcgatagaaaaagagtgaaaaaaaattggatgtatattttaaaactaattatcaaactttataatctataccaa 36254509  T
143 tatataaatctaattctaatcccct 167  Q
    |||||||||||||||||||||||||    
36254510 tatataaatctaattctaatcccct 36254534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University