View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2293_low_16 (Length: 238)
Name: NF2293_low_16
Description: NF2293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2293_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 43 - 167
Target Start/End: Original strand, 36254410 - 36254534
Alignment:
| Q |
43 |
tctttctttcatatagaaatttaaatgcgatagaaaaagagtgnnnnnnnnttggatgtatattttaaaactaattatcaaactttataatctataccaa |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36254410 |
tctttctttcatatagaaatttaaatgcgatagaaaaagagtgaaaaaaaattggatgtatattttaaaactaattatcaaactttataatctataccaa |
36254509 |
T |
 |
| Q |
143 |
tatataaatctaattctaatcccct |
167 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
36254510 |
tatataaatctaattctaatcccct |
36254534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University