View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2294_low_8 (Length: 263)
Name: NF2294_low_8
Description: NF2294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2294_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 47 - 248
Target Start/End: Original strand, 16189865 - 16190066
Alignment:
| Q |
47 |
catcaacaactctttcagaaaaagtgctagcatgaccaacctctctcaatatgaacaaccacctccacaagattccaaccccgccgatgccggttatgta |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16189865 |
catcaacaactctttcagaaaaagtgctagcatgaccaacctctctcaatatgaacaaccacctccacaagattccaaccccgccgatgccggttatgta |
16189964 |
T |
 |
| Q |
147 |
tccgatgacatcgttcacgcctctggtcgatccagagaacgcaaacgaggtcagtatttaaactagatacatcaacttttgtttgatctaccgcttatat |
246 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
16189965 |
tccgatgacatcgttcatgcctctggtcgatccagagaacgcaaacgaggtcagtatttaaaccagatacatcaacttttgtttgatctagtgcttatat |
16190064 |
T |
 |
| Q |
247 |
at |
248 |
Q |
| |
|
|| |
|
|
| T |
16190065 |
at |
16190066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University