View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2295_high_10 (Length: 298)
Name: NF2295_high_10
Description: NF2295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2295_high_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 50 - 291
Target Start/End: Complemental strand, 2782520 - 2782279
Alignment:
| Q |
50 |
tgttgttggtaacagcaacacagtggttacaaagggagatagtgggtacaaacttgggtccagtgccatgccaaggtgttaaagattgacaaatatggca |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2782520 |
tgttgttggtaacagcaacacagtggttacaaagggagatagtgggtacaaacttgggtccagtgccatgccaaggtgttaaagattgacaaatatggca |
2782421 |
T |
|
| Q |
150 |
gagaagaaacctgtgatgctttgtgactatgaagtttgcagtgtgaaccttagcatcacattcccaacaaaggcttgcctgatctgattcacagaacaac |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2782420 |
gagaagaaacctgtgatgctttgtgactatgaagtttgcagtgtgaaccttagcatcacattcccaacaaaggcttgcttgatctgattcacagaacaac |
2782321 |
T |
|
| Q |
250 |
tttgctggacttttgcacaactcacatttcttcttcatctca |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2782320 |
tttgctggacttttgcacaactcacatttcttcttcatctca |
2782279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University