View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2295_high_13 (Length: 257)
Name: NF2295_high_13
Description: NF2295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2295_high_13 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 15 - 257
Target Start/End: Complemental strand, 52926429 - 52926187
Alignment:
| Q |
15 |
gacagagcttacgttttggataagaccaaacatcttgcaagattcaatattcacgaagctggcaacgttctcttaaagcgtggccaaggcaaactcgaga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926429 |
gacagagcttacgttttggataagaccaaacatcttgcaagattcaatattcacgaagctggcaacgttctcttaaagcgtggccaaggcaaactcgaga |
52926330 |
T |
|
| Q |
115 |
aacaattccgcatgaattgcatcggttgcggtctctttgtttgctatcgctctcaacaagacttcgattcttcctctttcatttatgttcttgaccaagc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926329 |
aacaattccgcatgaattgcatcggttgcggtctctttgtttgctatcgctctcaacaagacttcgattcttcctctttcatttatgttcttgaccaagc |
52926230 |
T |
|
| Q |
215 |
actcagtactgttgctgctgaaaccaacccacaggatgctccc |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926229 |
actcagtactgttgctgctgaaaccaacccacaggatgctccc |
52926187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University