View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2295_high_15 (Length: 257)
Name: NF2295_high_15
Description: NF2295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2295_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 30 - 245
Target Start/End: Original strand, 39392402 - 39392617
Alignment:
| Q |
30 |
aatggaagttttttgattttagattgtctaaatttagtattattttcctctacatttggcttatacaattatagcttatgttcttaacccttaatttgta |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39392402 |
aatggaagttttttgattttagattgtctaaatttagtattattttcctctacatttggcttatacaattatagcttatgttcttaacccttaatttgta |
39392501 |
T |
 |
| Q |
130 |
accgaattttgaaaagtgttgggtgaaatattgcaatttgcaagcattggtttcttcacatcatttgaattcattggctgaaatgatgcatgtgcactta |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39392502 |
accgaattttgaaaagtgttgggtgaaatattgcaatttgcaagcattggtttcttctcatcatttgaattcattggctgaaatgatgcatgtgaactta |
39392601 |
T |
 |
| Q |
230 |
aaaattgttgcagaat |
245 |
Q |
| |
|
||||||| |||||||| |
|
|
| T |
39392602 |
aaaattggtgcagaat |
39392617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University