View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2295_low_17 (Length: 331)
Name: NF2295_low_17
Description: NF2295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2295_low_17 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 30 - 331
Target Start/End: Complemental strand, 34363102 - 34362801
Alignment:
| Q |
30 |
atatggatttacttgggttaactaagtgacaaaataggggtcgactagttagtgtggtacatatttctagttgtttagttacatatgtaatgttttataa |
129 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
34363102 |
atatggatttccttgggttaactaagtgacaaaataggggtcgattagttagtgtggtacttattgcccgttgtttagttacatatgtaatgttttataa |
34363003 |
T |
 |
| Q |
130 |
aaccacaattttatttcaataaagatttgtaactctttctttccatctgattattatgtcacatttcgatctcaacaatgcctaacaagattggtttgtc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34363002 |
aaccacaattttatttcaataaagatttataattctttctttccatctgattattatgtcacatttcgctctcaacaatgcctaacaagattggtttgtc |
34362903 |
T |
 |
| Q |
230 |
cccaaattttgccaaaatcctaaattcatttttcgtttctgattcacaaacttattctcatctgcacaaattacaatgacatcttcaaggtatacttatt |
329 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34362902 |
ctcaaattttgccaaaatcctaaattcatttttcgtttctgattcacaaacttattctcatctgcacaaattacaatgacatcttcaaggtatacttatt |
34362803 |
T |
 |
| Q |
330 |
gt |
331 |
Q |
| |
|
|| |
|
|
| T |
34362802 |
gt |
34362801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University