View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2295_low_24 (Length: 282)

Name: NF2295_low_24
Description: NF2295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2295_low_24
NF2295_low_24
[»] chr5 (1 HSPs)
chr5 (142-241)||(40795918-40796016)


Alignment Details
Target: chr5 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 142 - 241
Target Start/End: Complemental strand, 40796016 - 40795918
Alignment:
142 atttggcacttatttggtttgaagcaacactttagacttctaatgcatcgacacttttgaatgacgatttattttaagtatccaacatgtattgtctctg 241  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||| ||||||||||| ||||||| ||||    
40796016 atttggcacttatttggtttgaagcaacactttagacttctaatgcaccgacacttttgaatgacgatgtatttt-agtatccaacacgtattgtgtctg 40795918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University