View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2295_low_3 (Length: 522)
Name: NF2295_low_3
Description: NF2295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2295_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 395; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 395; E-Value: 0
Query Start/End: Original strand, 103 - 509
Target Start/End: Complemental strand, 28927476 - 28927070
Alignment:
| Q |
103 |
gaaagttgttttggcgtgtacggttttgggtgagtggggtgttgttgatgctatgattgagtatattgaggaaaataaggtggaggttgatgtttacttg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
28927476 |
gaaagttgttttggcgtgtacggttttgggtgagtggggtgttgttgatgctatgattgagtatattgaggaaaataaggtggaggttgatgtttacctg |
28927377 |
T |
|
| Q |
203 |
ggaaatacattgattgatatgtatggccggcgcagtatggttgatttggctcgacaagtgtttaatcggatgcgtgatagaaatatggtttcttggaatg |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28927376 |
ggaaatacattgattgatatgtatggccggcgcagtatggttgatttggctcgacgagtgtttgatcggatgcgtgatagaaatatggtttcttggaatg |
28927277 |
T |
|
| Q |
303 |
ctatgattatgggttatgggaaagcaggaaacttggttgctgcaaggaaattgtttgatgatatgccgcatagggatgtgatctcgtggacttctatgat |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28927276 |
ctatgattatgggttatgggaaagcaggaaacttggttgctgcaaggaaattgtttgatgatatgccgcatagggatgtgatctcgtggacttctatgat |
28927177 |
T |
|
| Q |
403 |
cagcagttactctcaagcgggtcagtttggaaaggcagtgaggcttttccaagaaatgatggttactaaggtgaagccagatgaaataacggttgccagt |
502 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28927176 |
cagcagttactctcaagcgggtcagtttggaaaggcagtgaggcttttccaagaaatgatggttactaaggtgaagccagatgaaataacggttgccagt |
28927077 |
T |
|
| Q |
503 |
gtgctct |
509 |
Q |
| |
|
||||||| |
|
|
| T |
28927076 |
gtgctct |
28927070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University