View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2295_low_37 (Length: 219)
Name: NF2295_low_37
Description: NF2295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2295_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 17 - 131
Target Start/End: Complemental strand, 515680 - 515566
Alignment:
| Q |
17 |
gggtttattatttcccacaaggtcacttagaaaatgcttctccttcttcttcctccattactcacacacactcttttctacaaagctttcgtcctttcac |
116 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
515680 |
gggtttattatttcccacaaggtcacctagaaaacgcttctccttcttcttcctccattactcacacacactcttttctacaaagttttcgtcctttcac |
515581 |
T |
 |
| Q |
117 |
tccttgtattgtctc |
131 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
515580 |
tctttgtattgtctc |
515566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University