View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2298_high_5 (Length: 246)
Name: NF2298_high_5
Description: NF2298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2298_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 9 - 230
Target Start/End: Complemental strand, 7122677 - 7122456
Alignment:
| Q |
9 |
agcagagaagagagtgactaacgctgttcttggaagtagtaattcccctggaggcgagaaccgaggcgatcaatggcttgtccagtttctcgaatccaaa |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7122677 |
agcagagaagagagtgactaacgctgttcttggaagtagtaattcccctggaggcgagaaccgagacgatcaatggcttgtccagtttctcgaatccaaa |
7122578 |
T |
 |
| Q |
109 |
atccaacgctgtatattgcttttcctagggttcccattttcgatggagaattcgaatttggatttccttaagcgatttagaataatttctccgtggtgtt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7122577 |
atccaacgctgtatattgcttttcctagggttcccattttcgatggagaattcgaatttggatttccttaagcgatttagaagaatttctccgtggtgtt |
7122478 |
T |
 |
| Q |
209 |
atggaatatgtgaagaaggaaa |
230 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
7122477 |
atggaatatgtgaagaaggaaa |
7122456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 64 - 147
Target Start/End: Complemental strand, 52412550 - 52412467
Alignment:
| Q |
64 |
gagaaccgaggcgatcaatggcttgtccagtttctcgaatccaaaatccaacgctgtatattgcttttcctagggttcccattt |
147 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||| | ||||||||||||||| ||| |||| ||||||||||||| |
|
|
| T |
52412550 |
gagaaccgaggcgatcaacggcttgtccagtttttcgaatcaactgtccaacgctgtatatcgctcttccgagggttcccattt |
52412467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 33 - 121
Target Start/End: Complemental strand, 7990336 - 7990248
Alignment:
| Q |
33 |
tgttcttggaagtagtaattcccctggaggcgagaaccgaggcgatcaatggcttgtccagtttctcgaatccaaaatccaacgctgta |
121 |
Q |
| |
|
|||||||||||| ||||||| || ||||| ||||||||||| |||||||||||||| |||||||| || ||||| ||||| ||| |||| |
|
|
| T |
7990336 |
tgttcttggaagaagtaattgccttggagacgagaaccgagacgatcaatggcttgaccagtttcgcggatccagaatccgacggtgta |
7990248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University