View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2299_low_10 (Length: 232)
Name: NF2299_low_10
Description: NF2299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2299_low_10 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 22956944 - 22956713
Alignment:
| Q |
1 |
ggttaaggaaaaataatagaatgatttttaatacttaattaattaagtaggtagttcacctaaccacgcatatgcggggaatggatttgctcaacaatac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22956944 |
ggttaaggaaaaataatagaatgatttttaatacttaattaattaagtaggtagttcacctaaccacgcatatgcggggaatggatttgctcaacaatac |
22956845 |
T |
 |
| Q |
101 |
gtcaataaaacttgcaaacctttaatgcgtaagtaaataaaacttgatttttgtgtgaaaaagtactccataagtcaataaaacttgggcaaggctcaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22956844 |
gtcaataaaacttgcaaacctttaatgcgtaagtaaataaaacttgatttttgtttgaaaaagtactccataagtcaataaaacttgggcaaggcccaag |
22956745 |
T |
 |
| Q |
201 |
aggcctaaactataagctgctattttagggac |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
22956744 |
aggcctaaactataagctgctattttagggac |
22956713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University