View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2299_low_6 (Length: 257)

Name: NF2299_low_6
Description: NF2299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2299_low_6
NF2299_low_6
[»] chr6 (2 HSPs)
chr6 (13-180)||(6970858-6971025)
chr6 (197-240)||(6970846-6970889)


Alignment Details
Target: chr6 (Bit Score: 156; Significance: 6e-83; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 13 - 180
Target Start/End: Complemental strand, 6971025 - 6970858
Alignment:
13 aatatgcatcttgagttttatttaatataatatataattcagtataatcataatacatattgcttgatctttgatcaaacaactatgatctactatatac 112  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6971025 aatatgcatcttgagttttatttaatataatatataatttagtataatcataatacatattgcttgatctttgatcaaacaactatgatctactatatac 6970926  T
113 attgacaatacagtgatttcattgtaccaaatccagattcgaggaagaaaagacaaaagagataaata 180  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||    
6970925 attgacaatacagtgatttcgttgtaccaaatccagattcgaggaagaaaagacaaaagaaataaata 6970858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 197 - 240
Target Start/End: Complemental strand, 6970889 - 6970846
Alignment:
197 attcaaggcagaaaagacaaaagagataaatagatggtcgtaat 240  Q
    |||| ||| ||||||||||||||| |||||||||||||||||||    
6970889 attcgaggaagaaaagacaaaagaaataaatagatggtcgtaat 6970846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University