View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2299_low_6 (Length: 257)
Name: NF2299_low_6
Description: NF2299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2299_low_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 6e-83; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 13 - 180
Target Start/End: Complemental strand, 6971025 - 6970858
Alignment:
| Q |
13 |
aatatgcatcttgagttttatttaatataatatataattcagtataatcataatacatattgcttgatctttgatcaaacaactatgatctactatatac |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6971025 |
aatatgcatcttgagttttatttaatataatatataatttagtataatcataatacatattgcttgatctttgatcaaacaactatgatctactatatac |
6970926 |
T |
|
| Q |
113 |
attgacaatacagtgatttcattgtaccaaatccagattcgaggaagaaaagacaaaagagataaata |
180 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6970925 |
attgacaatacagtgatttcgttgtaccaaatccagattcgaggaagaaaagacaaaagaaataaata |
6970858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 197 - 240
Target Start/End: Complemental strand, 6970889 - 6970846
Alignment:
| Q |
197 |
attcaaggcagaaaagacaaaagagataaatagatggtcgtaat |
240 |
Q |
| |
|
|||| ||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6970889 |
attcgaggaagaaaagacaaaagaaataaatagatggtcgtaat |
6970846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University