View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2299_low_8 (Length: 246)
Name: NF2299_low_8
Description: NF2299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2299_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 31138582 - 31138355
Alignment:
| Q |
1 |
gttcacatgagtggcaatcaactgtcaaaacatcaagttggcacattctccactgtctgtggaaactcaagcttgggcaagagctcagaggcaaccttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31138582 |
gttcacatgagtggcaatcaactgtcaaaacatcaagttggcacattctccactgtctgtggaaactcaagcttgggcaagagctcagaggcaaccttgt |
31138483 |
T |
 |
| Q |
101 |
caaatgggataaagttgacatgatttctgtttccattcatcacaatatttgacagacatgttacttcctgatctatcactttattttcaagaatgtcggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31138482 |
caaatgggataaagttgacatgatttctgtttccattcatcacaatatttgacagacatgttacttcctgatctatcactttcttttcaagaatgtcggt |
31138383 |
T |
 |
| Q |
201 |
ccaaaattcacgatcttcatggaagctc |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
31138382 |
ccaaaattcacgatcttcatggaagctc |
31138355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University