View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2300_low_5 (Length: 223)
Name: NF2300_low_5
Description: NF2300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2300_low_5 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 50 - 223
Target Start/End: Original strand, 35506298 - 35506471
Alignment:
| Q |
50 |
gttggtgttgttacaggttttgaagatgttcatgttaggtctaggaatgttcttgaattagaccttaaccttccggcaccggaggaagatctccgcgatt |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35506298 |
gttggtgttgttacaggttttgaagatgttcatgttaggtctaggaatgttcttgaattagaccttaaccttccggcaccggaggaagatctccgcgatt |
35506397 |
T |
|
| Q |
150 |
cgacgtttcagtttccggcgttggtgggttgccattattaggccagcgtgggatgaaggggaggggtttatatt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35506398 |
cgacgtttcagtttccggcgttggtgggttgccattattaggccagcgtgggatgaaggggaggggtttatatt |
35506471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 113 - 168
Target Start/End: Complemental strand, 20925644 - 20925589
Alignment:
| Q |
113 |
cttaaccttccggcaccggaggaagatctccgcgattcgacgtttcagtttccggc |
168 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||| |||| ||||||||||||||| |
|
|
| T |
20925644 |
cttaaccttccggcaccggaagaagatatccgcgaatcgaagtttcagtttccggc |
20925589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University