View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2300_low_8 (Length: 203)
Name: NF2300_low_8
Description: NF2300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2300_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 12 - 44
Target Start/End: Complemental strand, 34635421 - 34635389
Alignment:
| Q |
12 |
gtaaaatcccccaatttacaactttgcggaact |
44 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34635421 |
gtaaaatcccccaatttacaactttgcggaact |
34635389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University