View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2301_high_2 (Length: 319)
Name: NF2301_high_2
Description: NF2301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2301_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 3e-45; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 64 - 181
Target Start/End: Original strand, 41001050 - 41001169
Alignment:
| Q |
64 |
gagaaaagatgaattcctcctctaataccttat--tcaactttattctttttgtttcttttggatagaaaggaaacgatttagaaaatataaaaacaata |
161 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41001050 |
gagaaaaggagaattcctcctctaataccttatattcaactttattctttttgtttcttttggatagaaaggaaacgatttaacaaatataaaaacaata |
41001149 |
T |
|
| Q |
162 |
tgcatgctataattcttata |
181 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
41001150 |
tgcatgctataattcttata |
41001169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 4 - 45
Target Start/End: Original strand, 41001010 - 41001051
Alignment:
| Q |
4 |
actataatggctagcaattcttttcttctttcgtatggatga |
45 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41001010 |
actataatggctagcaattctttgcttctttcgtatggatga |
41001051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 227 - 267
Target Start/End: Original strand, 41001165 - 41001205
Alignment:
| Q |
227 |
ttatatgtttagtggcacattttccgtactggtgagtttat |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
41001165 |
ttatatgtttagtggcacattttccgtactcgcgagtttat |
41001205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University