View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2301_low_6 (Length: 256)
Name: NF2301_low_6
Description: NF2301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2301_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 97 - 200
Target Start/End: Complemental strand, 32746004 - 32745901
Alignment:
| Q |
97 |
ttttacttgcagtctccgtttatgtatttgatgggattttctcttgttctgattttgtcgaaaataaagagcaaggcaaaactcggaagctgaagaaaat |
196 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||| || |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32746004 |
ttttacttgcagtctccacttatgtatttgatgggattttctcttgttctgatttggtggaaaataaagagcaagacaaaactcggaagctgaagaaaat |
32745905 |
T |
|
| Q |
197 |
attg |
200 |
Q |
| |
|
|||| |
|
|
| T |
32745904 |
attg |
32745901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 28 - 81
Target Start/End: Complemental strand, 32746379 - 32746326
Alignment:
| Q |
28 |
cacgctctacaaggacgtggttttgaatctcactttcaacgtaaagatttcttc |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32746379 |
cacgctctacaaggacgtggttttgaatctcactttcgacgtaaagatttcttc |
32746326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 102 - 194
Target Start/End: Original strand, 3287422 - 3287514
Alignment:
| Q |
102 |
cttgcagtctccgtttatgtatttgatgggattttctcttgttctgattttgtcgaaaataaagagcaaggcaaaactcggaagctgaagaaa |
194 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| || ||||||||||| |
|
|
| T |
3287422 |
cttgcagtctccgcttatgtctttgatgggattttctcttgttctgatttggtcgaaaataaagagcaagaaaaaacatggcagctgaagaaa |
3287514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University