View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2303_low_3 (Length: 234)
Name: NF2303_low_3
Description: NF2303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2303_low_3 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 10 - 234
Target Start/End: Complemental strand, 26099803 - 26099579
Alignment:
| Q |
10 |
agatgaattcatgcgtacatgtgttagagcccagtaaaatgtatacataggctattttgtaatgattttgtatcactatctaagcatgtcttctcctttg |
109 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26099803 |
agatgaattcatgcgtacatgtgtaatagcccagtaaaatgtatacataggctattttgtaatgattttgtatcactatctaagcatgtcttctcctttg |
26099704 |
T |
|
| Q |
110 |
gcatgtggtagttaataaaatctgctttgcttttccaaaataacttagaattgcttgattactttgttacgagtcctaccgtaccaaattaagttcaatg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
26099703 |
gcatgtggtagttaataaaatctgctttgctttaccaaaataacttagaattgcttgattactttgttacgagtcctaccataccaaattaggttcaatg |
26099604 |
T |
|
| Q |
210 |
aatttagaaactttatactcaaatg |
234 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
26099603 |
aatttagaaactttatactcaaatg |
26099579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University