View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2304_low_2 (Length: 236)
Name: NF2304_low_2
Description: NF2304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2304_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 21876611 - 21876391
Alignment:
| Q |
1 |
aaatatctccttagccatgctttgtgtgtgagcagtgttttgtgtgaaatccatttcaccaattccatccagtttagcaagccattcttgattaggtttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21876611 |
aaatatctccttagccatgctttgtgtgtgagcagtgttttgtgtgaaatccatttcaccaattccatcaagtttagcaagccattcttgattaggtttg |
21876512 |
T |
|
| Q |
101 |
gccacaaaattattcaact---cctcaagttcatcaagttgaccagtcaattctctaggttcagtcattacatcatccaacttcacaaattcaccaaatt |
197 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
21876511 |
gccacaaaattattcaactcctcctcaagttcaccaagttgaccagtcaattctctaggttcagccattacatcatccaacttctcaacttcaccaaatt |
21876412 |
T |
|
| Q |
198 |
ggttagtgccagtagacaaaa |
218 |
Q |
| |
|
||||||||||||| ||||||| |
|
|
| T |
21876411 |
ggttagtgccagtggacaaaa |
21876391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 145 - 201
Target Start/End: Complemental strand, 19149686 - 19149630
Alignment:
| Q |
145 |
caattctctaggttcagtcattacatcatccaacttcacaaattcaccaaattggtt |
201 |
Q |
| |
|
|||||||| |||||||| ||||| ||||||||||| ||||| ||||||||||||||| |
|
|
| T |
19149686 |
caattctccaggttcagccattagatcatccaactccacaacttcaccaaattggtt |
19149630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University