View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2306_low_12 (Length: 361)
Name: NF2306_low_12
Description: NF2306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2306_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 91; Significance: 5e-44; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 241 - 335
Target Start/End: Original strand, 32866765 - 32866859
Alignment:
| Q |
241 |
ttagaatatgctagttttaaaaataaataattgatatataattttatacgtgtatgctcaaattattttattttgttatgtaatctatcaaatgc |
335 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32866765 |
ttagaatctgctagttttaaaaataaataattgatatataattttatacgtgtatgctcaaattattttattttgttatgtaatctatcaaatgc |
32866859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 14 - 94
Target Start/End: Original strand, 32866538 - 32866618
Alignment:
| Q |
14 |
aaaaacaatcatctttttcataaaaatctctcatctaacccggtgagtgctaattgccaacttatttttctgtttaccgtg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32866538 |
aaaaacaatcatctttttcataaaaatctctcatctaacccggtgagtgctaattgccaacttatttttctgtttaccgtg |
32866618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 160 - 217
Target Start/End: Original strand, 32866684 - 32866741
Alignment:
| Q |
160 |
ataaaacacgatttggtcgcaataaagttttggatggtcacgatttagacaaacaatc |
217 |
Q |
| |
|
|||||||| |||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32866684 |
ataaaacataatttggtcacaataaagttttgaatggtcacgatttagacaaacaatc |
32866741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University