View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2306_low_17 (Length: 258)
Name: NF2306_low_17
Description: NF2306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2306_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 17 - 247
Target Start/End: Complemental strand, 17814107 - 17813881
Alignment:
| Q |
17 |
aatcaggtcaggttccttggcctcaaaggaatagatggcagaacatgttgcatcttctcaggatcatgaactatattgttagtcacatctttaaagaagg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17814107 |
aatcaggtcaggttccttggcctcaaaggaatagatggcagaacatgttgcatcttctcaggatcatgaactatattgttagtcacatctttaaagaaga |
17814008 |
T |
 |
| Q |
117 |
aaatcaagttgcagacattattgctaacaagggcctcagtatgagctctattaggttttggcaggatgaccctttgtttattaagaaacttatgtgaaaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17814007 |
aaatcaagttgcagacattattgctaacaagggcctcactatgagctctattaggttttggcaggatgaccctttgtttattaag----ttatgtgaaaa |
17813912 |
T |
 |
| Q |
217 |
ataaactaggttggcatagtcttaggttcat |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
17813911 |
ataaactaggttggcatagtcttaggttcat |
17813881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University