View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2306_low_22 (Length: 223)
Name: NF2306_low_22
Description: NF2306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2306_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 23 - 217
Target Start/End: Original strand, 26957362 - 26957564
Alignment:
| Q |
23 |
attgataacactggtcaacacaattgcggctatagtgccgatttagtgtgta-------gtgtaatggaatttgcacaaaccgctannnnnnngcgatcc |
115 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26957362 |
attgataacattggttaacacaattgcggctatagtgccgatttagtgtgtactgtgtagtgtaatggaatttgcacaaaccgctatttttttgcgatcc |
26957461 |
T |
 |
| Q |
116 |
gctcaaaaacatatgtaagcaaattgaaaagggaacaaatagtgtacct-gaggaatgacacctatctcaaggagaagaggccccaaaataaatccacct |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26957462 |
gctcaaaaacatatgtaagcaaattgaaaagggaacaaattgtgtacctagagggatgacacctatctcaaggagaagaggccccaaaataaatccacct |
26957561 |
T |
 |
| Q |
215 |
cca |
217 |
Q |
| |
|
||| |
|
|
| T |
26957562 |
cca |
26957564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 217
Target Start/End: Complemental strand, 41776813 - 41776754
Alignment:
| Q |
158 |
tgtacctgaggaatgacacctatctcaaggagaagaggccccaaaataaatccacctcca |
217 |
Q |
| |
|
||||| ||||| |||||||| ||||||| ||||||||| |||| ||| |||||||||||| |
|
|
| T |
41776813 |
tgtacttgagggatgacaccgatctcaatgagaagagggcccagaatgaatccacctcca |
41776754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University