View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2306_low_9 (Length: 404)
Name: NF2306_low_9
Description: NF2306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2306_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 8e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 8e-77
Query Start/End: Original strand, 17 - 217
Target Start/End: Complemental strand, 49767180 - 49766980
Alignment:
| Q |
17 |
acaagatactattattttagatttggatgattcacatcctccacatggaacctatgaaaggannnnnnnnnnnnnnnnnaagagttaacattggtgttga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
49767180 |
acaagatactattattttagatttggatgattcacatcctccacatggaacctatgaaaggaggaggtggtggtggtggaagagttaacattggtgttga |
49767081 |
T |
|
| Q |
117 |
agatgattccattgatggcatgcaatgcattgatcatccatacagaaacaaccctggtgggatctgtgctttttgtcttcaagaaaaacttggtaaactc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49767080 |
agatgattccattgatggcatgcaatgcattgatcatccatatagaaacaaccctggtgggatctgtgctttttgtcttcaagaaaaacttggtaaactc |
49766981 |
T |
|
| Q |
217 |
g |
217 |
Q |
| |
|
| |
|
|
| T |
49766980 |
g |
49766980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 316 - 395
Target Start/End: Complemental strand, 49766881 - 49766799
Alignment:
| Q |
316 |
actactcgtcattgtccttcttcttcttc---catcaacactgtatcagctacaactgctgtaacttcatcttcttctctctc |
395 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
49766881 |
actactcgtcattgtccttcttcttcttcttccatcaacactgtatcagcaacaactgctgtaacttcatcttcttctctctc |
49766799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 14137707 - 14137753
Alignment:
| Q |
169 |
cctggtgggatctgtgctttttgtcttcaagaaaaacttggtaaact |
215 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14137707 |
cctggtggtatatgtgctttttgtcttcaagaaaaacttggtaaact |
14137753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University