View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2307_high_1 (Length: 298)
Name: NF2307_high_1
Description: NF2307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2307_high_1 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 121; Significance: 5e-62; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 4605459 - 4605227
Alignment:
| Q |
1 |
cacagataaacaacttgtttttgactaggattcttgaaatccatagtaaccaattgagagtctttttccaaccaaagagaggtcaaacc---nnnnnnnn |
97 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4605459 |
cacagataaaccacttgtttttgactaggattcttgaaatccatagtaaccaattgagagtctttttccaaccaaagagaggtcaaaccctttttttttt |
4605360 |
T |
|
| Q |
98 |
aaatctatctctattgcaatgcatagccccagtgacctctgcatgaaaagtagtagat-------aattttgnnnnnnnncactctacaaaagacatatt |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| ||| ||||||| |||||||| |
|
|
| T |
4605359 |
aaatctatctctattgcaatgcatagccccaatgacctctgcatgaaaagtagtagatatgtttaaattttg-aaaaaaacacgctacaaaggacatatt |
4605261 |
T |
|
| Q |
191 |
actatctctaaaattaccaccagaagcagttggt |
224 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
4605260 |
actatctctaaaaataccaccagaagcagttggt |
4605227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 45 - 89
Target Start/End: Original strand, 38531103 - 38531147
Alignment:
| Q |
45 |
agtaaccaattgagagtctttttccaaccaaagagaggtcaaacc |
89 |
Q |
| |
|
||||||||||| ||||| | ||| ||||||||||||||||||||| |
|
|
| T |
38531103 |
agtaaccaattaagagtatattttcaaccaaagagaggtcaaacc |
38531147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University