View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2308_high_4 (Length: 202)
Name: NF2308_high_4
Description: NF2308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2308_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 4e-40; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 107 - 190
Target Start/End: Original strand, 29735975 - 29736058
Alignment:
| Q |
107 |
attgtgaatgtaggttcgtgaagaaagggatcaaatgaaatgaatgttttgcaaggtttgggaattttctacgtttcgctttca |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29735975 |
attgtgaatgtaggttcgtgaagaaagggatcaaatgaaatgaatgttttgcaaggtttgggaattttctacgtttcgctttca |
29736058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 26 - 83
Target Start/End: Original strand, 29735895 - 29735952
Alignment:
| Q |
26 |
atgacagaaattgaaatttcatgtccttgtcgacatggctaagaaaaaacttgtatac |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29735895 |
atgacagaaattgaaatttcatgtccttgtcgacatggctaagaaaaaacttgtatac |
29735952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 74
Target Start/End: Complemental strand, 29732408 - 29732362
Alignment:
| Q |
28 |
gacagaaattgaaatttcatgtccttgtcgacatggctaagaaaaaa |
74 |
Q |
| |
|
|||| ||||||||||||||||||||| |||| ||| ||||||||||| |
|
|
| T |
29732408 |
gacataaattgaaatttcatgtccttatcgatatgtctaagaaaaaa |
29732362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 63; Significance: 1e-27; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 121 - 190
Target Start/End: Original strand, 32929959 - 32930029
Alignment:
| Q |
121 |
ttcgtgaagaaagggatcaaa-tgaaatgaatgttttgcaaggtttgggaattttctacgtttcgctttca |
190 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32929959 |
ttcgtgaagaaagggatcaaaatgaaatgaatgttttgcaaggtttgggaattttctacgtttcgctttca |
32930029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University