View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2309_low_3 (Length: 302)
Name: NF2309_low_3
Description: NF2309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2309_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 135 - 283
Target Start/End: Complemental strand, 53175081 - 53174933
Alignment:
| Q |
135 |
agaaaatatggttggaaaaggtggttatgctgaggtttacaagggaacattgaaaaatggtgaagaaattgctgtgaagagattaacaagagcttcaaag |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53175081 |
agaaaatatggttggaaaaggtggttatgctgaggtttacaagggaacattgaaaaatggtgaagaaattgctgtgaagagattaacaagagcttcaaag |
53174982 |
T |
|
| Q |
235 |
gatgaaagaaaagagaaagagtttttgacagagattggaacaattggtc |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53174981 |
gatgaaagaaaagagaaagagtttttgacagagattggaacaattggtc |
53174933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 18 - 56
Target Start/End: Complemental strand, 53175203 - 53175165
Alignment:
| Q |
18 |
ctaccaatggcttcaactcaggtgattaagacttgtttg |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53175203 |
ctaccaatggcttcaactcaggtgattaagacttgtttg |
53175165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University