View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2309_low_6 (Length: 241)
Name: NF2309_low_6
Description: NF2309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2309_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 25 - 233
Target Start/End: Complemental strand, 28524761 - 28524549
Alignment:
| Q |
25 |
gaatggggttgaatgatataatagggtttaccttgagaacggagagtgtagtatccatggtggtggtgaatgtgaatgaaggaggaagagaagacaaaaa |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28524761 |
gaatggggttgaatgatataatagggtttaccttgagaacggagagtgtggtatccatggtggtggtgaatgtgaatgaaggaggaagagaagacaaaaa |
28524662 |
T |
|
| Q |
125 |
gttcgaaatcgaagccgttcaactctcaactactgtgtcactgtcactgatatatac----ggtttcttcattggagtactctcactctctcatactccc |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28524661 |
gttcgaaatcgaagccgttcaactctcaactactgtgtcactgtcactgatatatactataagtttcttcattggagtactctcactctctcatactccc |
28524562 |
T |
|
| Q |
221 |
gccaattcatctc |
233 |
Q |
| |
|
||||||||||||| |
|
|
| T |
28524561 |
gccaattcatctc |
28524549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University