View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2310_high_18 (Length: 235)
Name: NF2310_high_18
Description: NF2310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2310_high_18 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 14 - 235
Target Start/End: Complemental strand, 30884163 - 30883942
Alignment:
| Q |
14 |
atatttaactagaacgtagatgtttgtcgcttttcattacaatgggagcctctgaattggtggagacgacgctgattcctcacaatgatatgcacattga |
113 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||||| |||||||||||||||| |||||||||| ||| |||||||||||||| |||||||||| |
|
|
| T |
30884163 |
atatttaactagaatgtagatgtttgtagcttttcattacaacgggagcctctgaattgttggagacgaccctggttcctcacaatgatctgcacattga |
30884064 |
T |
|
| Q |
114 |
actcttcttgtgcgaaatctttctcttgtagaaaggcaactcctcgtcgcgtgccacaagaaaactttaannnnnnnaggatttttcataatatagtgat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30884063 |
actcttcttgtgcgaaatctttctcttgtagaaaggcaactcctcgtcgcgtgccacaagaaaactttaatttttttaggatttttcataatatagtgat |
30883964 |
T |
|
| Q |
214 |
atggcgaccttgcattatactc |
235 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
30883963 |
atgccgaccttgcattatactc |
30883942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University