View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2310_high_19 (Length: 232)
Name: NF2310_high_19
Description: NF2310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2310_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 65 - 219
Target Start/End: Complemental strand, 5062760 - 5062605
Alignment:
| Q |
65 |
cttggtaaaaatagttacagaagactagatacattgcagtgattttgttaataa-gataatattcactttaaatccatatcctttcctaatttctaattc |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5062760 |
cttggtaaaaatagttacagaagactagatacattgcagtgattttgttaataaagataagattcactttaaatccatatcctttcctaatttctaattc |
5062661 |
T |
|
| Q |
164 |
tcaccggaccatgaggaacttggaggaaaaacaatactctctcatacctcaattat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5062660 |
tcaccggaccatgaggaacttggaggaaaaacaatactctctcatatctcaattat |
5062605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University