View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2310_low_30 (Length: 235)
Name: NF2310_low_30
Description: NF2310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2310_low_30 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 20 - 221
Target Start/End: Original strand, 42982329 - 42982531
Alignment:
| Q |
20 |
acaatggggggaaa-gaaattcccaaagaattatagtttccatttcagattaaaattctgaattttagtagaagcaattgtaggcttctttctttttatc |
118 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
42982329 |
acaatggggggaaaagaaattcccaaagaattatagtttccatttcagattaaaattctgacttttagtagaagcaattgtaggcttctttcttttaatc |
42982428 |
T |
|
| Q |
119 |
caattaaacacattttcagcaaacatgaatcctgaatcaactctccatttgtttgagacacaactataaaattaaaatcaccaatgggttcaaaacaaca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42982429 |
caattaaacacattttcagcaaacatgaatcctgaatcaattctccatttgtttgagacacaactataaaattaaaatcaccaatgggttcaaaacaaca |
42982528 |
T |
|
| Q |
219 |
tac |
221 |
Q |
| |
|
||| |
|
|
| T |
42982529 |
tac |
42982531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University