View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2310_low_34 (Length: 208)
Name: NF2310_low_34
Description: NF2310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2310_low_34 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 26 - 128
Target Start/End: Original strand, 12344657 - 12344759
Alignment:
| Q |
26 |
ctatgttactcttctttgttgtgaacacctactcagctattattatagagaaatcctcaagtaaaaggcacccatcatcattgataaacaaccaattata |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12344657 |
ctatgttactcttctttgttgtgaacacctactcagctattattatagagaaatcctcaagtaaaaggcacccatcatcattgataaacaaccaattata |
12344756 |
T |
 |
| Q |
126 |
tta |
128 |
Q |
| |
|
||| |
|
|
| T |
12344757 |
tta |
12344759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University