View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2311_high_7 (Length: 218)

Name: NF2311_high_7
Description: NF2311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2311_high_7
NF2311_high_7
[»] chr4 (1 HSPs)
chr4 (23-172)||(30716233-30716382)
[»] chr6 (1 HSPs)
chr6 (51-172)||(28118822-28118943)


Alignment Details
Target: chr4 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 23 - 172
Target Start/End: Original strand, 30716233 - 30716382
Alignment:
23 aaagatctttttagatgattttctatgggagaaagtagtggtctagggaagattgaaatgaatgaagatgaaaagggcggtgaaactgtggcnnnnnnnn 122  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||            
30716233 aaagatctttttagatgattttctatgggagaaagtagtggtctagggaagattgaaatgaacgaaggtgaaaagggcggtgaaactgtggcggggggag 30716332  T
123 natgaaaaaagaccagtggcaatgcacaaaaaatctgtgttagaagaaaa 172  Q
     ||||||| ||||||||| |||||||||||| | ||||||| ||||||||    
30716333 tatgaaaatagaccagtgtcaatgcacaaaacagctgtgttggaagaaaa 30716382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 51 - 172
Target Start/End: Original strand, 28118822 - 28118943
Alignment:
51 gagaaagtagtggtctagggaagattgaaatgaatgaagatgaaaagggcggtgaaactgtggcnnnnnnnnnatgaaaaaagaccagtggcaatgcaca 150  Q
    |||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||         ||||||| |||| ||||  ||||||||    
28118822 gagaaagtagtggtctagggaagattgaaatgaatggaggtgaaaagggcggtgaaactgtggcggggggagtatgaaaatagactagtgttaatgcaca 28118921  T
151 aaaaatctgtgttagaagaaaa 172  Q
    ||| |||| |||| ||||||||    
28118922 aaacatctctgttggaagaaaa 28118943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University