View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2311_low_2 (Length: 524)
Name: NF2311_low_2
Description: NF2311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2311_low_2 |
 | |
|
| [»] scaffold0007 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0007 (Bit Score: 289; Significance: 1e-162; HSPs: 2)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 19 - 347
Target Start/End: Complemental strand, 222936 - 222609
Alignment:
| Q |
19 |
gtagctacttagagaaagaacgtaaagatgagaattgttagagatgaaaaagccagttattattgcggattacagaagcgtcacaaaatccgtcatatat |
118 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
222936 |
gtagctacttagagaaagaacataaagatgagaattgctagagatgaaaattc-agttattattgcggattacagaagcgtcacaaaatccgtcatatac |
222838 |
T |
|
| Q |
119 |
tgtttatgacggatttttcagctttttgcaacagattcctaccatcactaaaagtgagttttttagtagtgagtaaggagaagtcagatattccggttaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
222837 |
tgtttatgacggatttttcagctttttgcaacagattcctaccatcactaaaagtgagttttttagtagtgagtaaggagaagtcagatattccggttaa |
222738 |
T |
|
| Q |
219 |
gtcgacaccctcaagaagctccaatcctctgcataatgaaacatttgataatacacatacgtacatttcaaaaagaaaacgcagaaaataaatccatttt |
318 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
222737 |
gtcgacaccctcgacaagctccaatcctctgcataatgaaacatttgataatacacatacgtacatttcaaaaagaaaacgcagaaaataaatccatttt |
222638 |
T |
|
| Q |
319 |
tggttactcaagaagtaataattaattgt |
347 |
Q |
| |
|
|||||||| |||||||||||||||||||| |
|
|
| T |
222637 |
tggttacttaagaagtaataattaattgt |
222609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 475 - 510
Target Start/End: Complemental strand, 222516 - 222481
Alignment:
| Q |
475 |
ttttcaaaatttcaaagaagaacaaaaacacatcat |
510 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
222516 |
ttttcaaaatttcaaagaagaacaaaaacacatcat |
222481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University