View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2312_high_104 (Length: 232)
Name: NF2312_high_104
Description: NF2312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2312_high_104 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 19 - 218
Target Start/End: Complemental strand, 32912522 - 32912323
Alignment:
| Q |
19 |
ctggttttaaatttagtaggttgctatattttattatgcaactacaactttgtttgttgtcgcaattctcttgttcatgaccatcatgcattttatatgt |
118 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32912522 |
ctggttttaaatttagtaggttgctgtattttattatgcaactataactttgtttgttgtcgcaattctcttgttcatgaccatcatgcattttatatgt |
32912423 |
T |
 |
| Q |
119 |
cactgctagttgaactgaagcacatgcagtgttagttactaacggtgcatttagtattttggttaattggcataatgaattactatgttgttggttggtg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
32912422 |
cactgctagttgaactgaagcacatgcagtgttagttactaacggtgcatttagtattttggttaattagcataatgaattagtatgttgttggttggtg |
32912323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University