View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2312_high_34 (Length: 365)
Name: NF2312_high_34
Description: NF2312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2312_high_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 86 - 279
Target Start/End: Complemental strand, 42679501 - 42679306
Alignment:
| Q |
86 |
acatttgatcaagggacgctatatagtcggtggctgtacatattcctgaagcagaaaatatcgcgtgttactatcccgatata--aattcataaagatgt |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42679501 |
acatttgatcaagggacgctatatagtcggtggctgtacatattcctgaagcagaaaatatcgcgtgttactatcccgatatataaattcataaagatgt |
42679402 |
T |
 |
| Q |
184 |
gttcaagacctattggtgttgctggacatattattcctaggaatttcccatcactaacgcgtaggtggtaaggttaaagaaaatcgtgttcgttag |
279 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42679401 |
gttcaaaacctattggtgttgctggacatattattcctaggaatttcccatcactaatgcttaggtggtaaggttaaagaaaatcgcgttcgttag |
42679306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University